image
image
image
Abse hlußbericht
(
'-a
a\

image
image
2
Begleitforschung
an
Freisetzungen
gentechnisch
veränderter
Pflanzen
in
Sachsen
AZ.
13.
8802.
35ufo/3. 2/96GEN
FZ.
O1l01-96-81
Abschlußbericht
über den Bewilligungszeitraum
vom
01 . 09. 1996
bis 31 .
08.
1
998
Prof. Dr. W.
Reißer
Universität
Leipzig
I nstitut
für Botanik/Al
lgemeine
und
Angewandte
Botanik
Johannisalle 22-23
04103
Leipzig
Prof. Dr.
Martin
Schlegel
Universität Leipzig
I nstitut für
Zoologie/Spezielle
Zoologie
Talstraße
33
O41O3
Leipzig

image
image
3
1 . Ziele
des Vorhabens
lm
Rahmen
der Begleitforschung
zur Freisetzung
von
transgenem
Raps
(Brassica
napus)
durch
die
Firma AgrEvo
auf
dem
Gelände
der
Agrargemeinschaft
Gnaschwitz,
Gemeinde
Gaußig,
Sachsen
wurden
folgende
Fragestellungen
untersucht:
o
Auskreuzungshäufigkeit
desHerbizidresistenz-Gens(Phosphinotricin-
Acetyltransferase-Gen:paf-Gen)
auf nicht
transgenen
Raps und auf
Rübsen
(Brassica
napa).
o
Ermittlung
der blütenbesuchenden
lnsekten
im Versuchsfeld
und im
angrenzenden
Gebiet
.
Untersuchung
der
blütenbesuchenden
lnsekten
auf
Pollenfracht
o
Analyse
der Pollenfracht
auf
Anwesenheit
des
paf-Gens
2. Vorversuche
im
Labor
2.1
lsolierung
von
Gesamt-DNA
Raps-Saatgut
der
Sorte
Falcon wurde
sowohl
nicht-gentechnisch
verändert,
als auch
mit dem
paf-Gen
en¡yorben.
Von beiden
m¡rde
DNA
isoliert
(Edwards
K et al.
1991)
Es
wurde
eine ausführliche Suche
nach
paf-Gensequenzen
in den
Genbanken
GenBank,
EMBL,
DDBJ u. PDB durchgeführt.
Mit
Hilfe eines
Alignierungs-
programmes (Align)
wurde
ein Paar Amplifikationsprimer
konstruiert:
PAT
1:
5'-
GGA GAG GAG
ACC AGT
TGA
GAT
TAG
-
3'
PAT 2:
5'-
GTA
ACT
GGC
CTA
ACT GGC
CT
-
3'
Diese
Primer weisen
die empfohlene
Übereinstimmung
in
Länge und
GC-Gehalt
von
ca.
50% auf und haben
somit in etwa
gleiche
Hybridisierungsbedingungen.
Sie
sind
zu
Regionen
des 5'- und 3'-Endes
des
paf-Genes
homolog
und
ergeben ein 534
Basenpaar langes
DNA-Fragment
in der
PCR
(Abb.
1).
Weitere
Primer wr.¡rden
vom lnstitut
für Molekulargenetik,
Fachbereich
Biologie
der
Universität
Mainz
bezogen. Diese
stammen
aus
verschiedenen
Bereichen des
paf-
Gens
und
erlauben es,
auch kleinere
Fragmente
zu
amplifizieren:
Das Primerpaar
P1,
P2 stammt
aus der Promotorregion
des
synthetischen
paf-Gens,
die Primer
T1,
T2
aus der
Terminatorseite.
Ein
drittes Primer-Paar
ist von
der
Sequenz
der 35-s-
CaMV-Promotors
des Transgen-Konstrukts
abgeleitet. Genaue
Versuchsprotokolle
zur
Durchführung
der
paf-Gen-Amplifikation
mit Hilfe der
PCR wurden
ebenfalls
vom
lnstitut
für Molekulargenetik
zur Verfügung
gestellt.
Zielwar es,
auszutesten, welche
Primer am
sensitivsten
sind,
d. h. mit möglichst
wenig Ausgangsmaterial
Amplifikationsprodukte
erhalten werden,
und andererseits,
welche
der Primer
am spezifischsten
sind, also
möglichst
wenige
Co-Amplifikations-
produkte
ergeben.
Die Konstruktion
eigener
Primer
war hierbei
schon deshalb nötig,

image
image
4
da aufgrund einer Vereinbarung
der
Universität
Mainz mit dem Landesamt für
Umwelt
und
Gewerbeaufsicht
(Rheinland-Pfalz)
die
Sequenz
der ennrorbenen
Prjmer
nicht mitgeteilt wurde.
Auch wir haben uns entschlossen, die
Sequenzen
unserer
Ampl ifi kationspri
mer vorerst nicht zu veröffentl ichen.
Abbildung
1: PCR
amplifizierte
paf-Genfragmente
nach Auftrennung im
1%igen
Agarosegel
und Anfärbung
mit Ethidium
bromid. Linke
Spur:
Molekulargewichtsmarker,
untere
prominente
Bande
entspricht
600 Basenpaaren;
mittlere
Spur:
PCR-Produkt
unter
Verwendung
der Primer
P2 und
T2; rechte
Spur:
PCR-Produkt
unter Verwendung
der
Primer
PAT
1 und PAT
2.
Das
mit unseren
Primern
amplifizierte
DNA-Fragment
urutrde in
den Vektor
pGEMT
kloniert
und sequenziert.
Es ergab sich
eine 100%ige
Sequenzübereinstimmung
mit
der
paf-Gen-Sequenzder
Firma AgrEvo
(Abb.
2).
Somit amplifizieren
die
gewâhlten
Primer
spezifisch
das
paf-Gen.
Für spätere
Hybridisierungszwecke
wurde
mit Hilfe
von Digoxygenin-1
1-dUTP
eine
hochsensitive nicht-radioaktive
Sonde
hergestellt,
um
zur PCR
eine alternative
und
komplementäre
Nachweismethode in
der Hand
zu
haben.

image
image
image
image
5
Reference
nolecul-e:
PÀT
ÀLIGNED
SEQUENCE
PRIN'IOUT
Page
1
9
-
542
(
534 bps)
Homology
1
-
534
(
534
bps)
100å
Open Gap
:
6;
Extend
Gap
:
2
2i
PÀTI2
Mis¡natch
=
10
20
30
40
50
60
tr**,***
PÀT
GGÀGÀGGÀGÀCCÀGTTGÀGÀTTÀGGCCAGCTÀCÀGCÀGCTGÀTÀTGGCCGCGGTTTGTGÀ
PÀTI2
PÀT
PÀT1 2
PÀT
PAT12
PÀT
PÀTl2
PÀT
PÀT12
PÀT
PAAl2
PÀT
PÀT12
PÀT
PÀT12
PAT
PAT12
190
,r
200
*
2).O
*
70
80
90
**
100
*
110
*
t20
*
TÀTCGTTÀÀCCÀTTÀCÀTTGÀGÀCGTCTÀCÀGTGÀÀCTTTÀGGÀCÀGAGCCÀCÀÀÀCÀCC
130
140
*tr
150
*
160
170
*
180
*
ÀCÀÀGÀGTGGÀTTGÀTGATCTÄGÀGÀGGTTGCÀÀGÀTÀGÀTÀCCCTTGGTTGGTTGCTGA
234
240
*.*
GGTTGAGGGTGTTGTGGCTGGTÀTTGCTTÀCGCTGGGCCCTGGÀÀGGCTÀGGAÀCGCTTÀ
250
*
260
*
270
*
2BO
,rt
290
*
300
*
CGÀTTGGÀCÀGTTGÀGAGTÀCTGTTTÀCGTGTCÀCATÀGGCÀTCÀÀÀGGTTGGGCCTÀGG
310
320
*
330
*
340
*
350
*
360
*
ÀTCCÀCÀTTGTÀCÀCÀCÀTTTGCTTÀÀGTCTÀTGGÀGGCGCÀÀGGTTTTAÀGTCTGTGGT
370
380
390
400
410
420
*****tr
TGCTGTTÀTÀGGCC'ITCCÀÀÀCGÀTCCÀTCTGTTÀGGTl'GCATGÀGGCTTTGGGÀTÀCÀC
430
*
440
*
450
460
*
470
*
ÀGCCCGGGGTÀCÀTTGCGCGCAGCTGGATÀCÀÀGCATGGTGGATGGCÀTGÀTGTTGGTTT
490
*
500
*
5Lo
*
520
*
t-
530
*
540
*
TTGGCÀÀÀGGGÀTTTTGÀGTTGCCÀGCTCCTCCÀIÀGGCCÀGTTÀGGCCAGTTÀC
\
Abbildung 2:
Sequenzvergleich
des mit den PAT
1 und PAT 2 Primern amplifizierten
Fragmentes
(PAT
12) mit der
paf-Gensequenz (PAT)
nach Angaben
der Firma AgrEvo.
Die
Sequenzübereinstimmung
beträgt 100o/o.

image
image
6
3.
Untersuchungen zur Ubertragung des
paf-Gens
von transgenen Pflanzen
auf
unveränderten Raps und Rübsen
3.1
Untersuchungen
aus
dem
Jahr
1997
Das Versuchsfeld war 36
x
125
m
groß
und in einem Abstand von 3 Metern von
einer
B m breiten Mantelsaat aus nicht-transgenem Raps umgeben
(Abb.
3). Konzentrisch
um das Versuchsfeld wurden an 35 Punkten
jeweils
100
getopfte
Pflanzen von
Raps,
Rübsen und Hederich
(Raphanus
raphanistrum) in 50 bis 400m Entfernung
entsprechend den Vorgaben
des Robert-Koch-lnstituts
auf stabilen Plastikfolien
ausgebracht und regelmäßig
gegossen
(Abb.
4 und 5).
Abbildung
3: Versuchsfeld mit transgenem
Raps
(TR)
und
nicht-transgener Mantelsaat.
Die Zahlen im Mantel
geben
die
sechs Punkte an, an denen
Samen
zur
Testung auf das
paf-Gen
entnommen
wurden. Der Entnahmepunkt 1 liegt
in
nördlicher
Richtung
(vgl.
mit
Abb.4).
Die Pflege dieser Akzeptorpflanzen
(,,Fangpflanzen")
en¡yies
sich
als sehr aufwendig
und teuer.
Es
gelang
jedoch,
eine hohe Blühsynchronisation bei Raps und
Rübsen
mit
den
Pflanzen im Versuchsfeld zu erreichen. Hederich
kam
nur vereinzeltzur
Blüte und
konnte bei den weiteren
Untersuchungen
nicht mehr berücksichtigt
werden. Dies
könnte durch die
Sorte
bedingt sein, die ven¡rendet wurde. Da in
Deutschland
keine Samen erhältlich waren, mußte auf
englisches
Saatgut
ausgewichen werden, das vielleicht bei uns nicht optimal
gedeiht.
Vor Erreichen der
Vollreife wurden
Raps und Rübsen
geerntet.
Die verbliebenen
Pflanzen
wurden in
das Versuchsfeld
eingebracht und durch die Firma AgrEvo mit den Versuchspflanzen
fachgerecht entsorgt. Aus der
Mantelsaat
wurden ebenfalls an 6 Punkten
Samen
entnommen
(Abb.
3). lnsgesamt standen aus dem Versuchsansatz
von 1997 ca.
1,75 Mill.
Rapssamen aus der
Mantelsaat,
6 M¡ll. Rapssamen aus den Topfpflanzen,
und 6,5
Mill. Rübsensamen aus den Topfpflanzen zur Verfügung.

image
image
image
image
image
7
50
-l-
¡
i
zron
I
I
ir
:d
i
i
I
I
I
I
I
I
100
nr
ì
-
ðll
/ lt
b
^
llL
/lt
ll
I
1,,.
{
t.
\
\
\
m
-\,
100
50
nt
rt.-I-
-
-
100
m
-?_--
-
-
:11
t50
¡n
t-
210 ¡n
Abbildung 4:
Anordnung
der
Meßpunkte
entlang der Meßstrecken
1 bis 7 um das
Versuchsfeld im
Jahr
1997.

image
image
image
I
Abbildung
5: ln
Töpfen auf Plastikfolien
ausgebrachte
Raps und
Rübsenpflanzen im
Jahr 1997.
3.1 .1
Untersuchungen
an Rübsen
3.1 .1.1 Resistenzbonitur
Das
Saatgut
wurde ab Oktober
1997 systematisch
in
Gewáchshäusern
der
Universität
Leipzig angekeimt
(Genehmigung
als S1
Labor liegt
vor).
Nach
Austrieb
von
1-2 Laubblättern
erfolgte
eine Resistenzbonitur
mit
dem Herbizid Basta nach
Angaben
des Herstellers
(lotoige
Lösung: 450p1
in 30ml HzOlm2).
Die überlebenden
Pflanzen
(Abb.
6) wurden
ausgezählt
und für weitere Untersuchungen
tiefgefroren.
Als Kontrolle
dienten Samen
transgener
und
nicht-transgener
Rapspflanzen, die
in
eigenen
Schalen
angezogen
und ebenfalls
der
Resistenzbonitur
unterzogen w-¡rden.
Zum Berichtszeitpunkt
sind die Rapspflanzen
aus der Mantelsaat
und bis auf
einige
Ausnahmen
(300m-Abstand)
von allen
Meßpunkten
untersucht.
Einige Meßpunkte
wurden
zweimal bearbeitet,
da Keimung
der
Pflanzen
und Erfolg der
Resistenzbonitur
auch
im
Gewächshaus
durchaus witterungsabhängig
waren.
Von
den einzelnen
Meßpunkten
wurden
in der Regel
zwischen
50.000 und 100.000
Pflanzen angekeimt
und
auf ihre Resistenz
getestet.
Hinter dieser
im
Gegensatzzu
anderen Untersuchungen
ungewöhnlich
hohen Zahl
stand die Überlegung,
eine
Auskreuzungshäufigkeit
von
0,05 % noch
einigermaßen
sicher nachweisen
zu
können:
Bei ca.
50% Keimung waren
dann noch
0,05 x250
=
12 bis
13
resistente
Pflanzen zu
erwarten,
Die Ergebnisse
zeigen, daß
diese Berechnung
sinnvoll war
und
an der Peripherie
des
Versuchsaufbaus
tatsächlich
solche Werte erhalten
wurden.
Von manchen
Punkten
konnten nur
erheblich
weniger
Samen
gesammelt
werden, da
durch
Wildverbiß viele
Pflanzen vernichtet
worden
waren. Die Ergebnisse
zur Übertragungshäufigkeit
des
paf-Gens
sind in Tabelle
1 zusammengestellt.

image
image
Abbildung
6: Resistenzbonitur
der
Keimlinge
aus
dem
Mantel
und
von den
verschiedenen
Meßpunkten
im Gewächshaus.
Je
500
Samen
wurden
in Schalen
angekeimt
und
nach
Austrieb
von
1 bis
2 Laubblättern
mit
Basta
behandelt.
Grüne
Pflanzen:
vor der
Basta
Behandung;
braune
Pflanzen:
nach
der
Basta
Behandlung,
einzelne
grüne
uberlebende
sind
zu
erkennen.

image
image
10
Die
wesentlichen
Ergebnisse
sind:
'
lnsgesamt
ist
eine
deutliche
Ausbreitung
des
paf-Gens
festzustellen.
Die
Daten
müssen
zudem
vor
dem
Hintergrund
geéehen
werden,
daß
keine
cms
(,,cytoplasmic
male
sterile")
sondern,,fêftile"
Rapspflanzen
als
Akzeptorpflanzen
ven'vendet
wurden,
die
in
der
Regel
selbstbestäubend
sind
und
Bestäubung
durch
Fremdpollen,
Voraussetzung
der
Resistenzübertragung,
nur
bis
zu
Z¡o/ovorkommt.
.
lm
50
m Abstand
wurden
genaus
gefunden
wie
in
der
Mantelsaat
(0,g4%
nimmt
die
Zahl
der
resistenten
pflanzen
Effektivität
der
Mantelsaat
als
Ausbreitun
'
lm
Gegensatzzu
den
ersten
Ergebnissen
scheint
sich
trotz
weiterhin
auftre-
tender
Schwankungen
im
Gesamtbilo
é¡ne
gewisse
Differenzierung
oeinusbrei-
tungshäufigkeit
zu
ergeben:
lm
nördlichen
Bereich
des
Versuchsfe'ides
(Mantel
6,
1
ertragungshäufigkeit
höher
als
im
süd_
rchgehend
die
niedrigsten
Werte).
Ein
Hilfe
eines
Mann-Whitney
U-Tests
ergibt
en
nördlichen
und
südlichen
Meßpunkten
n zum
nördlich gelegenen
Waldbereich
sudrichen
wiesenbereich.
r
lnsekten
einfliegen
als
aus
dem
'
Auch
in 400-
m
Entfernung
ließen
sich
noch
transgene
pflanzen
in
einer
Häufigkeit
von
0,1%
nachweisen.
Dies
ist
nach
unserem
Wissen
der
entfernteste
Meßpunkt,
von
dem
zuverlässige
Daten
vorliegen.
ln
früheren
stuJien
loale
et
al.
1993)
wurden
bereits
abTO
m
Entfernung
keine
resistenten
pflanzen
rè¡¡.
gefunden.
Allerdings
war
hier
das
Versuchsfeld
mit
-9
m Durchmesser
wesenflich
kleiner.
Auch
die
Werte
der
Niedersächsischen
Arbeitsgruppe
liegen
unter
den
hier
dargestellten.
ln
200m
Entfernung
wurden
1996
0%
oisb,cjiyr,lõw
o,o1o/o
bis
0,02y.
(mit
einem
Extrem
von
0,8%)
resistente
Pflanzen
festgestelit.
Allerdings
waren
hier
die
Zahlen
der
aufgestellten
,,Fangpfranzen"
pro
Meßpunkt
mit
4
(1ggõ)
und
o
1t
óoz¡
um
Größenor{nungel
geringer
als
in
unserem
Versuch.
lm
Rahmen
des
Verbund-
projektes
FORBIoSICH-Projekt
Bayern
wurden
ebenfalls geringere
Werte
erzielt.
Bei
4?
^
Entfernung
vom
Versuchsfeld
waren
es
nur
0,037o
rerirte'ntu
pflanzen,
mehr
als
eine
Größenorg.nung
geringer
als
unsere
Werte.
Die
Autoren
selbst
sehen
jedoch
ihre
Werte
an
der
Untergrenze
der
in
der
Literatur
angegebenen
Fremdbefruchtungs-
raten'
Die
Untersc
en
könnten
ãuicn
die
verschiedenen
Stich-
proben
bedingt
se
sition
zu
der
nahegelegenen
Waldfläche
in
unserem
Versuch
höheren
Werten
oéitra-gen.
Gestützt
wird
diese
Annahme
durch
die
Untersuchungen
zu
den
blütenbesucheñden
lnsekten,
die
ergaben,
daß
vor
allem
Wildbienen
und
Schwebfliegen
die
aus
dem
Umland
einflie-
gen
als Pollentransporteure
in
Frage
kommen
1s.
S.t).
Weiterhin
stutzen
diese
Er-
gebnisse
die
Hypothese,
daß
die
Ausbreitungsiraufig'keit
des
paf-Gens
áuch
mit
der
Größe
des
Versuchsfeldes
korreliert
ist.
1.Eine
Berechnung
nach
dem
t-Test
ist
in
diesem
Fall
nicht
zulässig,
da
die
werte
nicht
normalverteilt
sind,
sondern
asymmetrisch,
nach
außen
abnehmend
(Noftz
rggsi

image
image
11
Tabelle
1:
Ubertragungshäufigkeit
des
paf-Gens
von transgenen
Pflanzen
im
Versuchsfeld
auf
nicht
genetisch
veränderte
Rapspflanzen
Meßpunkt
Ausgesäte
Samen
%
gekeimt
Zahl
der
Uberl. %
Uberl./
Gekeimte
Durchschnitt
Kontrolle
1 000
50
C
0
Transgene
1 000
50
ca.
50C
100
Mantel
1
135.000
40
octr
1,71
0,84
+l-
0,67
Mantel 2
65.50C
50
337
1,03
Mantel
2 wh
74.50C
50
185
0.5c
Mantel 3
70.00c
50
131
o,37
Mlantel
3 wh
66.50C
50
157
o,47
Mlantel
4
64.50C
5C
91
0.28
Mantel
5
67.000
5C
128
0,38
Mantel 6
65.000
50
649
2,OO
Rapsl
50m
93.000
70
556
0,85
0,84
+/-
0,56
Raps2
50m
44.OOO
70
629
2.O4
Raps3
50m
102.00c
70
477
0.67
Raps4
50m
68.00c
50
238
o,7c
Raps5
50m
102.50C
50
319
o,62
Raps6
50m
102.00c
50
128
o.25
RapsT
50m
95.00c
45
332
0.7t
Raps4
75m
86.00c
70
284
o,47
0,56
Raps4
75m wh
95.50C
5C
308
0,65
Rapsl
100m
102.00c
5C
285
0,56
O,43
+l-
O,12
Raps2
100m
108.00c
5C
252
o,47
Raps3
100m
108.50C
5C
287
0,53
Raps5 100m
98.50C
5C
195
0,4c
Raps6
100m
108.00c
5C
133
o,25
RapsT
100m
67.50C
6C
14A
0,35
Rapsl
21Om
37.50C
6C
49
o,22
0,24
+l-
O,2
Raps2
21Om
27.OOA
6C
2e
0,16
Raps5
21Om
36.000
6C
2r
o,12
Raps5 210
vvfi
102.000
6C
144
o,24
Raps6 21Om
102.000
60
4C
0,07
RapsT 21Om
4.000
60
15
0,63
Raps2
25Om
6.000
60
I
0,22
Raps2 350m
20.50c
60
I
0,07

image
image
image
12
Rapsl
400m
8.000
60
11
0,23
0,1 1
RapsS
400m
94.000
60
50
0,09
Raps6
400m
108.000
75
45
0,06
RapsT
400m
102.000
75
56
0,07
3.1.1.2
Nachweis des
paf-Gens
in Basta resistenten
Pflanzen
Zum
Nachweis des
paf-Gens
wurde
DNA aus den tiefgefrorenen
resistenten
Pflanzen
isoliert
und das
Gen entweder durch
PCR
(Abb.
7) oder,,dot-blot"-
Hybridisierung
nachgewiesen
(Abb.
8).
Von allen Meßpunkten
wurden
bislang
mindestens
fünf Pflanzen
getestet
und in den
meisten Fällen das
paÊGen
nach-
gewiesen.
ln
manchen Fällen waren die Signale
in der,,dot-blot"
Hybridisierung
schwach und
dann auf der Fotografie schlecht
zu
sehen
(Abb.
8). Dennoch
gehen
wir
davon aus, daß auch
in
diesen
Fällen das
paf-Gen
vorhanden ist.
Die
PCR des
paf-Gens
mit unseren Primern liefert
hier fotografisch
leichter zu dokumentierende
Ergebnisse
(Abb.
7),
ist
aber teurer
und viel
zeitaufrruendiger.
Für
die
geplante
Ver-
öffentl
ich u ng werden noch entsprechende
PC R Amplifikationen d
u rchgefü hrt.
t4 ts16t7
20
2223
Abbildung
7: PCR-amplifiziertes
paf-Genfragment
aus
Rapspflanzen nach
Auftrennung im
1%igen
Agarosegel und Anfärbung mit
Ethidiumbromid.
Spur 1
,
2: DNA
transgener
Pflanzen
(Positivkontrolle);
Spur 3,
4: DNA
Basta resistenter Pflanzen
(50
m Meßpunkt);
Spur 5, 6: Kontrollpräparation ohne
DNA; Spur
7, 8. DNA Basta
resistenter Pflanzen
(100
m Meßpunkt); Spur 9
-
15: DNA Basta resistenter
Pflanzen
(50
m Meßpunkt);
Spur 16
-
23: DNA Basta resistenter
Pflanzen
(75
m
Meßpunkt); Spur
24: Kontrollpräparation
ohne
DNA.
L9
ft
ffi, Ëil *#
*
.ffi
Ëñ ffi
ffi
?.r¡
ffi
ffÞ W
€&,'rlr''j'j:$'r:':ii
ürpr5
lIHüË
,*,llrll
-lÍ*,
*
¿tt'.,
'Þ,
u,
fir.ri,
':i¡
,',
ti.
.'
#
t"r;
dt,

image
image
image
13
(oben)
B 1-5: Mantel
1;
C 1-5: Mantel3;
D 1-5: Mantel5;
B 6-10: Mantel2
C 6-10: Mantel4
D 6-10: Mantel6
Abbildung
8: Nachweis
des Resistenzgens mit
Hilfe der
dot-blot Methode.
Je 1Opl aus
einer DNA
Präparation
von überlebenden Pflanzen
aller Meßpunkte
wurden
Vakuum
getrocknet,
in 2pl
sterilem
destilliertem Wasser
resuspendiert,
10 Minuten
bei 95oC denaturiert
und auf eine Nylon
Membran
(Boehringer)
getropft
und im
UV-Licht an die
Membran
gebunden.
Die Hybridisierung
mit
der Digoxygenin markierten
paf-Probe
erfolgte
bei65oC. Die
Detektion
der Hybrisdisierung erfolgte
mit anti-Digoxygenin
konjugiert mit Alkalischer
Phosphatase
entsprechend
den Vorschriften des
Herstellers.
Membran 1 : A 1-5: transgene Rapspflanzen
(Positivkontrolle);
A 6-10:
Negativkontrolle;
E 1-5: Meßstrecke
1, 50 m;
E 6-10: Meßstrecke
2,50
m
F 1-5: Meßstrecke
3,50 m;
F 6-10: Meßstrecke
4,
50
m
G 1-5: Meßstrecke
5, 50 m;
G 6-10: Meßstrecke
6, 50 m
H 1-5: Meßstrecke
7, 50 m;
H
6-10: Meßstrecke
4,75
m
I 1-5: Meßstrecke
1,
100
m; I
6-10: Meßstrecke
2, 100 m
Membran
2: A 1-5: Positivkontrolle:
A
6-1 0: Negativkontrolle
(unten)
B
1-5: Meßstrecke
3, 100 m;
B 6-10:
Meßstrecke
5, 100 m
C 1-5: Meßstrecke
6, 100 m;
C 6-10: Meßstrecke
7,
100 m
D 1-5; Meßstrecke
1, 210 m,
D 6-10: Meßstrecke
2,
210 m
E 1-5:
Meßstrecke 5,210 mi
E 6-10: Meßstrecke
ô, 210 m
F 1-5: Meßstrecke 7,210
m; F
6-10: keine Proben
aufgetragen
G 1-5:
Meßstrecke 2,250 m:
G 6-10: Meßstrecke
2, 350 m
H 1-5: Meßstrecke 1,400 m;
H 6-10: Meßstrecke
5,400 m
I 1-5: Meßstrecke
6,400 m;
I 6-10: Meßstrecke
7,400m

image
image
14
Aus
neun
resistenten
Nachkommen
von
Akzeptorpflanzen
rurde
zusätzlich
DNA
mit
der
Restriktionsenendonuclease
Hind
lll
geschnitten,
gelelektrophoretisch aufge-
trennt
und
auf eine
Nylonmembran
geblottet
(southern-transfer).
Anschließend
erfolgte
eine
Hybridisierung
mit Digoxygenin
markierter
paf-DNA (Abb
9).
Das
Ergebnis
zeigt,
daß
in den
Nachkommen
entweder
eine
oder
zwei
Kopien
unterschiedlicher
Länge
vorhanden
sind.
Den
Angaben
von
AgrEvo
zufolge
enthielten
die ursprünglich
transformierten
Pflanzen
zwei
Kopien
auf
einem 7
Kb und
4 Kb
Fragment.
In unseren
Positiv-Kontrollen
(transgene
Pflanzen
aus
dem
Versuchsfeld)wurde
nur
das 7 Kb
Fragment
detektiert.
Dies
könnte
ein
Hinweis
auf
eine
lnstabilität
des
transgenen Genotyps
sein.
Abbildung
9. Zahl
der
Genkopien
im Genom
der
Basta resistenten
Rapspflanzen
Spur
1, 13: Molekulargewichtsmarker
Spur2-10:
Basta
resistente
Rapspflanzen
aus dem
Mantel.
Spur
1 1,12:
transgene
Pflanzen
aus dem
Versuchsfeld
3.1.2 Untersuchungen
an Rübsen
Mit
der Testung
der 1997
ausgebrachten
Rübsen
wurde
begonnen.
Es
liegt ein
Wert
für
die
Meßstrecke
3 aus 50
m Entfernung
vor.
Es
wurden
108.000
Pflanzen
ange-
keimt.
Die Keimung
war bei
den Rübsen
mit
80% etwas
besser
als beim
Raps.
Von
ca. 86.400
Keimlingen
überlebten
85. Dies
entspricht
einer Übertragungshäufigkeit
von 0,17o.
3.2 Untersuchungen
aus
dem
Jahr
1998
lm
zvrrciten Jahr
des
Projektes
wurden
zur Überprüfung
der Daten
an 12
Punkten im
Abstand
von
25, 50
und 75 m wiederum
getopfte
Raps-Pflanzen
ausgebracht
(Abb.
1O)
und
synchron mit
den Pflanzen
im
Versuchsfeld
zum Blühen
gebracht (Abb.
11).
Rübsen
wurden
in diesem
Versuch
an drei
Positionen
(West,
Nord und Ost)
inner-
halb
des
Versuchsfeldes
aufgestellt.
Zusätzlich
wurde
wiederum Saatgut
aus sechs
Punkten
in der Mantelsaat
gewonnen.
Um
zum
Berichtszeitpunkt
eine etwas
breitere

image
image
image
image
15
Datenbasis
zur übertragungshäufigkeit
von
Raps
auf
Rübsen
zu
erhalten,
wurden
die
Rübsen
zuerst
unteisucit
(Tabélle
2).
Die
Werte
liegen
hier
im
selben
Bereich
*¡"
O"i
der Übertragung
des
paf-Gens
von
Raps
auf
Raps,
zwischen
0,46%
und
1,360/o.
lra
^
ouo
-
\
^\
1.
5u8
4.l
,.n
lu.i
2Éñ
a
x
a
26 m
,ut
*
,t; *
60
aa
m
6() ñ
76
at
m
Z6 ñ
x*
Abbildung
10:
Versuchsanordnung
im Jahr
1998.
TR: Transgener
Raps,
M:
Mantelsaat,
X: Standort
einer
Malaisefalle.
+-

image
image
16
Tabelle
2: Übertragungshäufigkeit
des
pat-Gens
von
transgenem
Raps
auf Rübsen
im
Versuchsfeld
Abbildung
11:
Getopfte,
blühsynchrone
Rapspflanzen
im
zweiten
Versuchsjahr'
Rechts
im Bild
ist
ein Teil
des
Versuchsfeldes
zu
erkennen.
4. Untersuchungen
zur
Verbreitung
von
Pollen
durch
Wind
1997 und
1998
An allen
Meßpunkten,
sowie
in der
Mantelsaat
und an
zwei
Punkten
innerhalb
des
Versuchsfeldes
r¡n7urden
Vaseline
beschichtete
Objektträger
ausgebracht.
Zusätzlich
wurde
im Mai
1998
eine
Pollenfanganlage
für
je
einen
Tag in
25 m,50
m und
100
m
Abstand
aufgestellt.
Die Auswertung
ist
noch
nicht
erfolgt.
Meßpunkt
Ausgesäte
Samen
%
gekeimt
Zahl
der
über-
lebenden
Pfl.
% überlebende/
oekeimte
Pflanzen
West
48.000
85
220
0,54
Nord
101.000
80
1107
1,37
Ost
48.000
85
191
0.47

image
image
17
5.
Erfassung
der
blütenbesuchenden
lnsekten
1997
und
1998
Zum
Fang
der
blütenbesuchenden
lnsekten
wurden
drei
Methoden
eingesetzt:
n¡àL"is"t"jte
(Abb. 12), Gelbschalen
(Abb. 14)
und
Kescherfänge'
Bei
der
Malaisefalle
handelt
es
sich
um
eine
kontinuierliche
Fangeinrichtung
flugaktiver
lnsekten.
Die
Malaisefalle
war
an
sechs
verschiedenen
Positionen
im
Mai-
Juni
während
der
glunze¡t
aufgestellt
(Abb. 13):
im Grasbereich
zwischen
Mantelsaat
ùnO
tr"nrgenem
Rãps,
Meßlin'ie
2,
in
SOm
und
150m
Abstand,
Meßlinie
6,
100m,
300m
und
400m
Abàtand
vom
Versuchsfeld.
1998
wurde
die
Malaisefalle
an
fünf
verschiedenen
Punkten
aufgestellt:
im Grasbereich
zwischen
den
transgenen
pflanzen
innerhalb
des
VerJuchsfeldes,
sowie
in
25
m
und
50
m
Abständen
(Abb'
10)
Abbildung
12:
Malaisefalle
im
Versuchsfeld
aufgestellt.
Rechts:
transgener
Raps,
links
Mantel.
Gelbschalen
dienen
ebenfalls
dem
kontinuierlichen
Fang.
Hauptsächlich
werden
jetO
Oevorzugende
flugaktive
lnsekten
erfaßt.
Gelbschalen
wurden
sowohl
im
úersuchsfeld,
als
auch
in
den
einzelnen
Meßpunkten
augebracht'
Kescherfang
ist
ein
subjektiver
Sich
besucher
gekeschert
i-m
Versuchsfeld
ausschl
h
auf
Rübsen
und
Hederich.
lm
angrenzenden
Um
er
ebenfalls
ãino"rog"n.
Am
Waidsaum
waren
dies
ve
Giersch'
Distel)'
im
Wiesénbereich
Ranunculus
sp,
Iaraxacum
sp,
ebenfalls
gelbblühende
Arten'

image
image
image
18
,..(--
Abbildung
13:
Standorte
der Malaisefalle
im ersten
Versuchsjahr
1997
Abbildung
14: Gelbschalen
im Versuchsfeld

image
image
19
Alle
drei
Methoden
zusammen
werden
ein
einigermaßen
vollständiges
Bild
der
blütenbesuchenden
Insekten
während
der
Rapsblüte
ergeben.
Die
taxonomische
Auswertung
ist
noch
nicht
abgeschlossen.
Dies
erforderte
die
Versendung
des
gesammelien
Materials
an
diverse Spezialisten,
und
noch
nicht
alle Taxa
sind
ãeterminiert.
Folgendes
Bild
ergibt
sich
aus
den teilweise
ausgewerteten
Kescher-
fängen
und
aus
den
Malaisefallen
von
1997.
5.1
Kescherfänge:
Auf
Rapsblüten
wr.lrden
Vertreter
von
sechs
Insektenordnungen
gefangen:
Hautflügler
(HymenoPtera)
Zweiflügler
(Diptera)
Käfer
(Coleoptera)
Wanzen
(HeteroPtera)
Zi
kaden
(AuchenorrhYncha)
Schlammfliegen
(MegaloPtera)
Insgesamt
konnten
mehr
als
100
verschiedene
Taxa
(Arten) fast
regelmäßig
nach-
g"ù"r"n werden.
Ein Massenbesuch
einzelner
Arten
w'urde
nicht
festgestellt.
Eine
Áusnahme
bildet
der
Rapsglanzkäfer
(Metigethes aeneus),
der
zum
Massenvorkom-
men
neigt.
Die
taxonomische
Bearbeitung
der
Schwebfliegen
aus
den
Kescherfängen
ist abge-
schlossen
(s.
Anhang).
Ingesamt
wurden
419 lndividuen
gefangen, die
78
Arten
angehören.
An
vier
Tãgen
wurde
im Versuchsfeld
und
in
der Mantelsaat
gekeschert
1td'.
S.,
15.
5., 22.5.
und
10. 6.1997).
Dabeiwrden
insgesamt
18 Arten
mit
35
individuen
erfaßt.
lm
Bereich
um
das
Versuchsfeld
konnten
56 Arten
mit
305
lndividuen
nachgewiesen
werden.
lm
unmittelbar
angrenzenden
Umland
38 Arten
mit
79
lndividuen.
Dle relativ
geringen
lndividuenzahlen
sind
zumindest
teilweise
durch
eine,,schonende"
Vorgehensweise
beim Keschern
zurückzuführen.
Es mußte
darauf
g"a"ñtet werden,
daß
einerseits
die
Akzeptorpflanzen
nicht
in
Mitleidenschaft
!"=og"n
werden,
und
andererseits
die
potientiellen
Vektoren
transgenen
Pollens
ñi"nt-qu"ntitativ
weggefangen
und
somit
die
Ergebnisse
der
Auskreuzungshäufig-
keiten
stark
verfälscht
werden.
Bemerkenswert
ist,
daß
der
grÖßte
Teil
der
im
Feldbereich
festgestellten
Arten
aus
dem
entfernteren
Umland
einwandern
muß.
Dies
ergibt
sich
ãus
der Biologie
der
einzelnen
Arten.
Die
Larvalhabitate
befinden
sich
im Wald,
bzw.
im Saumbereich
Acker-Wald
und
Acker-Wiese.
Die Tiere
migrie-
ren
folglich
aus
diesen
Bereichen
in
den
Ackerbereich
hinein,
um
Nahrung
von
den
Rapsbluten
zu
sammeln.
Eine
Rückwanderung
in
diese
Bereiche
erfolgt
unmittelbar
anschließend.
Ein Pollentransfer
ist
wahrscheinlich.
5.1.1
pollenfracht
an
den
blütenbesuchenden
lnsekten
aus
den
Kescherfängen
lnsgesamt
konnte
bislang
bei
12
Arten
eine
deutliche
Pollenfracht
nachgewiesen
werden:
6 Arten
von
Hautlüglern
aus
der
Bienenverwandtschaft,
sowie
6
Schwebfliegen-Arten.
GroßsMengen
an
Pollen
wurden
an
Hummeln
gefunden,
jedoch
selten
beobachtet.
Die Gesamtindividuenzahl
war
ebenfalls
gering,
39
Hymenopteren
und
26 Syrphiden.
In der
Häufigkeit
der
Pollenfracht
ergab
sich
folgende
Verteilung:

image
image
20
Andrena
(wildbienen)
>
Eristalis
(schwebfliegen)
>
Apis
(Honigbiene)
>
Bombus
(Hummeln)
>
EmPis
5.2
Malaisefallen
1997
lm
Versuchsfeld
und
im
Bereich
der
Akzeptorpflanzen
wurde
mit
den Malaisefallen
eine
reichhaltige
lnsektenfauna
nachgewiesen
(s.
Anhang).
ln
einigen.Taxa
treten
hohe
lndividueizahlen
auf.
Tiere
mit
deutlich
sichtbarer
Pollenfracht
sind
selten
und
beschränken
sich
auf
Bienen
(Gattung
Andrena)
und Schwebfliegen.
Somit
erbrach-
ten
die
Malaisefallen
keine
wesentlichen
neuen
Erkenntnisse
gegenüber
den
Kesch-
erfängen.
Aufgrund
der hohen
Gesamtindividuenzahl
kann
jedoch
nichl
ausgeschlos-
sen
vierden,
dãß
selbst
der
Transport
von
einzelnen
oder
wenigen
Pollen
für die
Ausbreitung
des
paf-Gens
bedeutend
sein
kann.
Neu
und
unseres
Erachtens
bedeutend
ist
die Erkenntnis,
daß
vorrangig
Wildbienen
und Schwebfliegen
als Pollentransporteure
auftreten,
und nicht
etwa Honigbienen,
wie
dies
bisher
angenomm.en
wurde.
Diese
Arten
sind
weniger
blütenstet
als
Honig-
bienen.
Dadurch
wird
die übertragungshäufigkeit
auf
andere
Arten
potentiell
erhöht.
6.
Untersuchung
von
Pollen
an
lnsekten
auf Anwesenheit
des
paf-Gens
Bislang
wurden
sieben
Individuen
untersuchl
(1
Andrena
sp
aus
dem
Versuchsfeld;
4
Andreña
sp,
1 weitere
solitäre
Biene
und
1
Ensfa/rs
tenax
aus
der
Mantelsaat).
Der
anhaftende
Pollen
wurde
isoliert
und
daraus
DNA
gewonnen. Zunächst
wurde
mit
den
von
uns
konstruierten
Primern
PATI
und
Pat
2
eine
Amplifikation
des
paf-Gens
durchgeführt.
Nach
der
Elektrophorese
zeigte
sich
ein Amplifikationsprodukt
bei
der
positiùkontrolle
und
bei
der
Probe
aus
dem
Versuchsfeld.
Bei
den
Pollen
aus
den
Tieren,
die
in der
Mantelsaat
gefangen
wurden,
war
zunächst
das
paf-Gen
nicht
nachweisbar
(Abb.15,
linke
Hãttte¡.
Oaraufhin
wurde
eine
zweite,
sogenannte
,,nested
pCR"
durchgeführt.
Dabei
wird
mit
einem
zweiten
Primerpaar,
da9
innerhalb
der
Sequenz
lielt,
die
von
ersten
Primerpaar
amplifiziert
wird,
eine
PCR
durchgeführt.
Als
ïemplatã
Oient
nicht
genomische DNA,
sondern
ein
kleines
Volumen
(ca.
1pl)
der
ersten
pcR-Reaktion.
Mii
dieser
Methode
konnte
die Anwesenheit
des
paf-Gens
bei
allen
proben
nachgewiesen
werden
(Abb.
15,
rechte
Hälfte).
Eine
Hybridisierung
auf
alle
Amplifikationsþrodukte
nach
Southern-Transfer
mit
der
Digoxygenin-markierten
Sonde
àrgab,
daß bereits
bei
der
ersten
PCR
das
pat-Gen amplifiziert
worden
war,
lediglich
viel
geringerer
Menge
als
in
der
zweiten,
nested
PCR
(Abb.16). Der Nach-
weið
des
pat-Gens
gelang
auch
aus
alkoholkonserviertem
Pollen'
Es
gelang
weiterhin,
mit
einem
geeigneten Puffer
durch
osmotischen
Schock
Pollen-
proioptasãn aus
der
Hülle
zu
isolieren.
Damit
sind
die
Voraussetzungen
für Versuche
gescnatfen, das
paf-Gen
mit
Hilfe
von
in
situ-Hybridisierungen
in
Polllenkörnern
nachzuweisen
(Abb.
17).

image
image
image
image
21
Erste PCR
rrìit
PAT1
/PAT 2 Prlnrern
Zwelte PCR
mit
p2lT2
prtrnern
P M
M
M M
MM M
P M M
MM MM
M
Insekt
aus
:
P=
PAT
Feld,
M= Mantel
Abbildung
l5: PCR-amplifiziertes pat-Genfragment
aus
pollenkörnern,
die
von
verschiedenen
lnsekten
isoliert
wurden,
nach
Auftrennung
im 1%igen
Agaroseget
und
Anfilrbung
mit Ethidiumbromid.
Spur
1,
20: Molekulargewichtsmarker;
spur 2-10:
PGR-Amplifikation
mit dem Primerpaar
pATl
und
pAT
2. Nur
bei
der
Positivkontrolle
(spur
2) und
einer
Biene
aus dem versuchsfeld (spur
3) ist ein
Amplifikationsprodukt
zu
erkennen.
Als Positivkontrotle
diente das
rekombinante
pGEMT
Plasmid
mit dem
534
Basenpaar-Fragment
des
pat-Gens.
Spur
I
1-19: Reamplifikation
mit einem,,nested
primer,,-paar.
Abbildung
l6:
Hybridisierung
mit
Digoxygenin
markierter
paf-DNA
auf PGR-Fragmente
(Abb.
15)
nach
Southern-Transfer.
trÞ
Ho.,.,o'rr,,rr,,x't
n¡(JqJOC)
* õ
B
B
*
ä.H
n
9
g.
E. H. I E I H
Ë Þ
E Ì H Ë i f i
Ë
ä
å
:
f
I I lt I ä
åË
ç t Ë Ë Ë-s
È Ë E Ë ü €-Ë-Ë-Ë
È-s E
Ë
F
=
f å
ã å
3
å
E i
f
{ € å
ã
3
{,i
,;
I 2
3 4 5 ó
1 8 9
10
l1 t2
13 t4
15
16
t7
18
Ig
20
*n*nr*t¡:¡rñ

image
image
22
Abbildung
17:
Pollenprotoplasten
nach
osmotischem
schock.
1:
unbehandelte
põiiÀnrtir-ner;
2:
po¡énkörñer
nach
schockbehandlung;
3: stärkere
vergrößerung
von
2.

image
image
23
7. Schlußfolgerungen,
Kommentar
zum
verlauf
des Projektes
Diese
Untersuchungen
haben
bereits
vorliegende
Ergebnisse
anderer
Projekte
quantitativ
betätigt
und
en¡reitert.
Vor
allem
wurden
jedoch
einige
wesentliche
neue
Erkenntnisse
gewonnen:
.
Ein
Transfer
des
paf-Gens
auf
nicht-transgeng
Rapspflanzen
ließ sich
bis
in
400
m Entfernúng
sicher
nachweisen.
Die
Übertragungshäufigkeit
ist
höher
ats in
der
Literatur
und
von
anderen
Arbeitsgruppen
angegeben.
.
Die
Mantetsaat
stellt
womöglich
keine
effektive
Ausbreitungsbarriere
des
paf-Gens
dar.
o
Die hauptsächlichen
Pollenüberträger
unter
den
lnsekten
sind
blütenunstete
Wildbienen
und
Schwebfliegen,
nicht
blütenstete
Honigbienen.
Die
molekularbiologischen
Techniken
und
Laborarbeiten
funktionierten
einwandfrei.
N
ach
anfängl
ichen Schwieri
gkeiten
waren
auch
die Gewächshausarbeiten
(Ankeimen, êießen,
Resistenzbonitur)
rasch
etabliert.
Die Ernte
der
Samen
aus
den
Akzeptorpflanzen
und
die
systematische
Ankeimung
und
Testung
der Pflanzen
aus
der
Mantelsaat
und
der
einzelnen
Meßpunkte
bereitete
einen
viel
hÖheren
Arbeitsaufi¡rand,
als
wir
uns vorgestellt
hatten.
Als
alternative
Methode
wurde
versucht,
Pflanzen
in Petrischalen
im
Klimaraum
anzukeimen
und zu
behandeln.
Es
zeigte
sich
jedoch,
daß
dies
keine
wesentliche
Zeitersparnis
erbringt
und
zudem
noðn
weiteie Sachkosten
für den
Kauf
von
großen
Mengen
an
Petrischalen
bedeutet
hätte.
Ein
weiterer
Grund,
die
bisherige
Methode
beizubehalten,
liegt in
der
Ver-
gleichbarkeit der Ergebnisse.
Auch
der
Gedanke,
alle noch
zu
verbleibenden
Tests
in
éin"r
großen
Versuchsansatz
auf
dem
Versuchsgelände
in Gaußig
durchzuführen,
w.¡rde
ãlr
=,
riskant
eingestuft
und
von
der
Firma
AgrEvo
aus
verständlichen
Grün-
den
auch
nicht
sonderlich
befürwortet.
Der
für
den Versuch
benutzte
Teil
des
Gelän-
des wäre
über Jahre
für
weitere
Freisetzungsexperimente
nicht
zu nutzen
gewesen.
Die Untersuchungen
wurden
daher
in
erprobter
Weise
fortgesetzt
und
durch
die
Unterstützung
voñ
zwei
technischen
Mitarbeitern
auch
gut
vorangetrieben.
Wir
werden
die
Untersuchungen
erst beenden,
wenn
alle
Meßpunkte
abgearbeitet
sind.
Des
weiteren
wollen
wir
unbedingt
unsere
brisanten
Ergebnisse
im Hinblick
auf die
Funktion
der
Mantelsaat
als Ausbreitungsbarriere
überprüfen.
Außerdem
müssen
die
Untersuchungen
zur
Verbreitung
von
Pollen
durch
Wind
abgeschlossen
und weitere
pollenanalysen
auf
Anwesenheit
des
paf-Gens
durchgeführt,
sowie
die
restlichen
Fal lenfänge
ausgewertet
werden.
8. Darstellung
des
Projektes
nach
Außen
Am
16.
Dezember
1997
fand
in
Hannover
auf Einladung
der
damaligen
Umweltministerin
M. Griefahn
ein
Fachgespräch,,Stand
der Sicherheitsforschung
zur
Freisetzung
gentechnisch
veränderter
Pflanzen"
statt.
Auf
dieser
Veranstaltung
hat
einer
von
uns ausführlich
über
unser
Projekt
und die
bis
zu
jenem
Zeitpunkt
erzielten
Ergebnisse
berichtet.
Es zeigte
sich,
daß
unsere
Ergebnisse
mit
denen
anderer

image
image
24
Arbeitgruppen
gut
übereinstimmen.
Besonderheiten
im Profil
der sächsichen
Begleitforschung
gegenuber
anderen
Projekten
zeigten
sich in
folgenden Punkten:
.
Es
wurde eine
hohe Zahl
von
Standorten
für
Akzeptorpflanzen
im Abstand
bis
zu 4OO
m
gewáhlt.
o
Pro
Standort
rurden
viele Pflanzen
aufgestellt
(100
gegenüber
4-6).
o
Pro
Standort
werden
zwei Pflanzenarten
untersucht
(Raps
und Rübsen)
o
Das Artenspektrum
der blütenbesuchenden
lnsekten
und ihre
ökologische
Bedeutung
wird bisher
in keinem anderen
Projekt
in dieser
Breite
berücksichtigt.
Am
9. Februar
1999 werden
die erzielten
Ergebnisse
unter
besonderer Berück-
sichtigung
der Pollenüberträger
im
Kolloquium
,,Acker-
und Pflanzenbau"
der
Landwirtschaftlichen
Fakultät der
Martin-Luther-Universität
Halle
vorgestellt.
Eine kurze
Darstellung
des Projektes
erfolgte
in der
zweiten Ausgabe
des
Kursbuchs
Umwelt.
Ausführlicher
ist der Überblick
im
Bundesgesundheitsblatt
41, 552
-559
(s.
Anlage).
Von diesem
Artikel wird eine
Kurzfassung
in der
Zeitschrift
,,Biologie
in
unserer
Zeit" im Frühjahr
1999 erscheinen.
9. Literatur
Bortz
J
(1985)
Lehrbuch der
Statistik.
Springer-Verlag
Dale PJ,
Parkinson R,
Scheffler
JA
(1993):
Dispersal of
genes
by
pollen.
The
prosamo
project.
BCBP Monograph
N0
55:
Opportunities
for molecular
biology in
crop
production,
133-1
42
Edwards
KC,
Johnstone
C, Thompson
C
(1991):
A simple
and rapid
method for the
preparation
of
plant
genomic
DNA for PCR
analysis. Nucl.
Acids Res.
19, 1349
Danksagung
Wir danken dem Sächsischen
Staatsministerium
für Umwelt
und Landwirtschaft
für
die
großzügige
Förderung
dieses
Projektes,
sowie
der Firma AgrEvo
für eine
viermonatige
Anschlußfinanzierung.
Für die Betreuung
vor Ort
bedanken
wir uns bei
Frau
Kummer,
Firma BioChem
GmbH
und
Herrn
Liebelt, Agrargenossenschaft
Gaußig.
Der
Kanzler
der
Universität
P.
Gutjahr-Löser
hat in
großzügiger
Weise
Gewächshausflächen
der
Universität
zur
Verfügung
gestellt.
Wir
danken außerdem
Herrn
Dr. H. Pellmann
und Herrn M. Sci. Stan
Theophilou,
sowie unseren
technischen
Mitarbeitern, Frau A.
Körner und
Herrn M. Förster
für ihre
engagierte
Mitarbeit.
Prof.
Dr. M.
Schlegel
Prof.
Dr. W,
Reißer

image
image
Begleitforschung
an
Freisetzungen
gentechnisch
veränderter
Pflanzen in
Sachsen
Anhang zum
Abschlußbericht
o
Taxa-Zusammensetzung
der
Kescherfänge 1997
.
Taxa-Zusammensetzung
der Malaisefänge 1997
.
Sonderdruck:
Pellmann
H, Reißer W, Theophilou
S,
Schlegel
M
(f
999): Begleitforschung
zu Freisetzungen
gentechnisch
veränderter
Pflanzen
in Sachsen. Bundesgesundheitsblatt
41,
552-559
o
Sonderdruck
:
Schlegel M, Reißer W
(1999):
Begleitforschung
zu Freisetzungen
gentechnisch
veränderter Pflanzen
in
Sachsen.
Kursbuch
Umwelt 2, 14-15

image
image
image
T
axa-Zusammensetzung
KescherfÌinge
Gaußig 1 997
aus
Feldfringen
Familie/Sattung
Att
Auchenorrhyzrcha
Cercops
sanguinea
CoJ.eoptera
Cantharidae
mehrere
Arten
Hippodamia
13-punctata
Ma-Iachius
aeneus
Meligethes
aeneus
Diptera
Bibionidae
mehrere
Arten
Conopidae
mehrere
ArLen
Empis
mehrere
Arten
Muscidae
mehrere
Arten
Sarcophagidae
mehrere
Arten
Scatophaga
eine
Art
Syrphidae
56
Arten
Tipulidae
eine
Art
Eeteroptera
Elmenoptera
Megaloptera
Dolycorus
Eurydema
Andrena
Apis
Apoidea
Bombus
Symphyta
Siali
s
baccarum
oleraeeum
mehrere
Arten
melfifera
mehrere Arten
2
Arten
mehrere
Arten
eine Art

image
image
image
image
image
m/w Nr,
D;ANM
VOL.
BfuIERKUNG
193
L997-05-22
-LsO
o.H.
194
1-997-05-22
-]-50
m-.Ìf,'
rena
eln
groß
gr
-Z¿
__LJV
LIL.LL}
-22 -L50
o.H.
202
l-997-05-22 -I50
o . H.
62
l-997-05-15
-l-50
o.H'
33 0
]-997
-05-22
+l-0 0
si----lq'L
'-
00
o.
H.
oar"
mel-Iifera
32g
Lggl-05-22
-L50
o'H'
ep:-s
inellifera
L90
L991-05-22
+1-00
o'H'
apis
mellifera
198
1997-05-22
-L50
o'H'
Apis
mel-Iifera
20I
1.99'7-05-22
-L50
o'H'
epis
mellifera
203
1'997-05-22
-I50
o'H'
eþis
mellifera
L95
1-991-05-22
-ts}
o'H'
eþis
mellifera
67
1997-05-L5
+150 o'H'
aþis
mellifera
64
1997-05-l-5
-150
o
'
H'
apis
mellifera
63
1997-05-l-5
-150
o
'H'
-J
Aois
mel-l-if
era
59
l-997-05-1-5
-150
o
'
H
'
v
epis
mel-Iifera
61
l-997-05-l-5
-150
o
'
H'
apis
meflifera
69
1997-05-l-5
+100
o'H'
apis
mellifera
60
1997-05-1-5
-150
o'H'
Empis
204
199'l-05-22
-l-50
nmpis
L91
L991-05-22
-150
emþis
A¡drena
331
L991-05-22
-150
o'H'
rmþis
1-91
1997-05-22
-l-50
umþis
196
199'1-05-22
-Lso
nmþis
2oo
1'997-05-22
-L5o
-Brnø"
S27
1997-05-
2
+1
nmþis
65
L997-05-15
-150
Eristalis
pratorum
't^¡
328
L991
-05-22
+7 5
Eristalis
arbustorum
$r
7L
1997-05-15
+200
Eristalis
pratorum
I^r
68
l-997-05-15
-1-50
Meligethes
aeneus
5
?0
l-997-05-15
-150
?
o
ll¿,^

image
image
image
image
Andrena
__-sËqß__._
"__33!_-
_t991_os_22_é_þ_Q____pþLt_es
-
Andrena
-_-gréß--
932
lggi-os-22 +7s
o.H.
Mantelsaat
C¿ATTANG
Andrena
Andrena
Apis
Apis
Api-s
-Apis
Apis
Apis
Apis
Conopidae
DoJ-ycorus
Empis
Empis
Eristal-i-s
Eristal-is
Eurydema
Melanostoma
Platycheirus
Rhingia
Scatophaga
Scatophaga
Scatophaga
Scatophaga
Sphaerophoria
Syritta
Syrphus
ARN
mell-ifera
mell-ifera
mellifera
mel-l-if
era
mellifera
mel-Iif
era
mel-Iifera
baccarum
nemorum
nemorum
oleraceum
scalare
albimanus
campestrì-s
?
pipiens
rj-besíi
úw
¡rr.
DATUM
VOL. BEMERKUNG
1 5
1997-05-15
-150
m. H.
11
1997-05-15 +200
o.H.
605
1997-05-15
-l_50
80
1997-05-15 +150
o.H.
IL
l-997-0_5_-_15-'l_lÞ_9..-__!ß-U,
608 1997-05-15
-l-50
o
. H.
564 1997-05-l-5
-150
o.
H.
588 1997-05-15
-150
Pol]en
16 r-ee7ìs:Js
--rõo
o. H.
18
1997-05-15 +200
84
1997-05-15 +150
336
!991-05-22
+150
333
1997-Q5-22
-L50
33s
1,991-05-22
-r50
33'7
]991-05-22 +10
0
593 1997-05-t_5
-150
83
1997-05-15
+150
85
1_997-05-15
+150
82
l_997-05-15 +150
565
1997-05-t_5
-150
512 1997-05-15
-l_50
575
1997-05-15
-t_50
587
l_997-05-15
-150
580
l_997-0s-15
-t_s0
59 4
1997- 05-15
_ __1.-5_Q _^_ BeI_IeA
'79
1997-05-1_5
+150
m
m
m
m
w
w
w
m
?¿(i
¿*,
r
Jr'x

image
image
image
image
image
I
I
Sektor
1
GATTI'NG
50m
Andrena
Andrena
Andrena
Andrena
---Apis
Apis
Apoidea
Apoidea
Empis
Empis
Eristalis
Eristalis
Eristal-is
Eristal-is
Eristalis
Eristalis
Eristal-ís
'-Eristal-is
-Eristalis
Eristalis
'Melanostoma
Parasyrphus
Parasyrphus
Sarcophagidae
Scatophaga
Symphyta
Symphyta
Syrphus
Syrphus
7OO m
Api-s
ApJ-s
Bombus
Empis
Eristalis
Eristalis
Eristalis
Eristalis
Eristalis
Eristalis
Eurydema
Muscidae
Scatophaga
Scatophaga
Scatophaga
Scatophaga
Slmphyta
Symphyta
Symphyta
Syrphus
Syrphus
75O m
Andrena
Andrena
Andrena
AA'Y
groß
klein
melfifera
mel-lifera
kl-ein
nemorum
nemorum
rremorum
arbustorum
nemorum
nemorum
arbustorum
arbustorum
pertinax
nemorum
mellinum
annulatus
annulatus
schw
schw
ribesii
ribesii-
mell-i f era
mellifera
Ab rot
nemorum
nemorum
nemorum
pertinax
nemorum
nemorum
oleraceum
schw
schw
schw
torvus
torvus
m/w
¡f.r.
DA.TUM
VOLVM Bø'IERI<VNG
Elv
+75
o.H.
+75
o.H.
-150_
__
B-o_ll-e.n
-150
_-
P_o_!l_e_q-
-150
o. H.
+10
0
+100
o. H.
-l-50
o. H.
+l-00
-150
+15
0
-150
-150
-150
-150
-t_50
_
_J l-
s_0__
__P_o,L!e¡l-
+l-50
PoIIen
+15
0
+75
+75
+75
-150
+75
+15
0
-150
+15
0
+75
-l_5
0
Pol-Ien
m
m
w
m
w
w
w
w
\"¡
m
W
m
m
tB2
1997-05-29
170 ]-997-05-29
519
1997-05-15
518 1997-05-15
-
264
1991-05-22
522 1997-05-1s
241, t997-05-22
260 1991-05-22
263 L997-05-22
290
L991-05-22
L64
1,991-05-29
262 r99'l
-05-22
261
L991-05-22
261 ]-997-05-22
291
1991-05-22
266
1991-05-22
511
1997-05-15
5t2
1997-05-1s
523
1997-05-1s
517
1997-05-1s
187 1,99'l-05-29
158
t991-05-29
520
1997-05-15
259
1997-05-22
515
1997-05-15
265
1991-05-22
52L
1997-05-15
1,16 1,997
-05-29
s16 1997-05-l-5
w
m
1_7 5
157
163
548
181
L52
t_5
1
l- 69
525
5??
534
206
429
430
ZZJ
529
524
526
521
532
528
].991-05-29
+1s0
1,997-05-29
-75
]-991-05-29
-150
1997-05-15
-150
1,ss7
-
05-29
'+7
5
L99'7-05-29
+150
t997-05-29
+75
L997-05-29
+l_50
1997-05-15
-150
1997-05-l-5
+100
1997-05-15
+120
L991-05-22
-150
1991-05-22
+100
L997-05-22
+100
L997-05-22
-L50
t_997-05-15
-150
1997-05-l-5
+75
l-997-05-15
-150
1997-05-15
+150
1997-05-15
+l-50
1997-05-15
-l_50
m, H.
m. H.
o. H.
-!9_1_1en
hI
m
m
w
w
m
bt
m
1s0
]-991-05-29
t44 t997-05-29
561
1997-05-15
+75
o.H.
+75
o.H.
groß
-150
o. H.

image
image
image